Kidney Res Clin Pract > Volume 44(4); 2025 > Article
Jang, Hwang, Choi, Kim, Park, Kim, Kwon, and Kim: Evaluation of the novel ALK5 inhibitor EW-7197 on therapeutic efficacy in renal fibrosis using a three-dimensional chip model

Abstract

Background

EW-7197, a potent oral ALK5 inhibitor, was assessed for its impact on transforming growth factor beta 1 (TGF-β1)–induced fibrosis in a three-dimensional (3D) renal fibrosis-on-a-chip and a mouse model. The evaluation included tubular epithelial-mesenchymal transition, angiogenesis, and inflammatory cytokine expression.

Methods

In a 3D renal fibrosis-on-a-chip model, three cell types(kidney fibroblasts, human proximal tubular cells, and human umbilical vein endothelial cells) were cultured and treated with TGF-β1 and EW-7197. Alpha smooth muscle actin (α-SMA) and keratin 8 (KRT-8) was assessed, angiogenesis observed via confocal microscopy, and cytokine levels measured by polymerase chain reaction, immunoassay, and enzyme-linked immunosorbent assay. In a cisplatin-induced renal fibrosis mouse model, blood urea nitrogen levels, TGF-β, and Smad 2/3 were determined, and fibrosis was assessed with Masson’s trichrome stain.

Results

The α-SMA expression was significantly lower in the EW-7197 group than in the TGF-β fibrosis group. TGF-β decreased the expression of the epithelial marker KRT-8, an effect that was reversed by EW-7197 and SB431542. In the TGF-β–induced fibrosis model, the length of the thick vessels was reduced, and the diameter of both thick and thin vessels was decreased, but EW-7197 reversed these effects. EW-7197 significantly reduced the messenger RNA expression of TGF-β and increased the levels of vascular endothelial growth factor receptor 2, interleukin (IL)-10, and IL-6. EW-7197 reduced the levels of secretory cytokines TGF-β1, TGF-β3, IL-1β. In the cisplatin-induced renal fibrosis mouse model, EW-7197 reduced renal fibrosis by down-regulating TGF-β signaling.

Conclusion

EW-7197 attenuated the TGF-β1–induced fibrotic cellular response in the 3D chip model and animal model. These findings indicate the potential effect of EW-7197 in attenuating renal fibrosis.

Graphical abstract

Introduction

Owing to progressive population aging, the prevalence rates of diabetes and hypertension have shown an increasing trend. This has also contributed to an increase in the number of individuals with chronic kidney disease (CKD). Despite advances in the management of CKD, the occurrence of renal fibrosis during CKD progression remains a significant challenge [1]. Renal fibrosis is caused by the deposition of extracellular matrix (ECM) due to inflammation. It typically worsens over time and eventually results in end-stage renal failure. Molecules or signaling pathways related to renal fibrosis are a contemporary research hotspot. The pathophysiology of renal fibrosis involves dedifferentiation of fibroblasts into myofibroblasts through transforming growth factor (TGF)-β and Wnt signaling, accumulation of ECM, proliferation of fibroblasts, and recruitment of macrophages and lymphocytes into the renal interstitium [2].
Renin-angiotensin system (RAS) blockade and sodium-glucose cotransporter 2 (SGLT2) inhibitors have been reported to inhibit CKD progression by inhibiting activation of AT1 signaling [3]. In animal models, RAS antagonists were shown to reduce tubular interstitial inflammation and fibrosis by reducing TGF-β production or inhibiting NLRP3 inflammasome [4,5]. The reno-protective effects of SGLT2 are known to be independent of RAS blockade, and their effects include improved mitochondrial function and reduced inflammation and fibrosis [6]. Their mechanisms include inhibition of endoplasmic reticulum stress, reduction of TGF-β expression, and suppression of epithelial-mesenchymal transition (EMT). The common mechanisms of the anti-fibrosis effects of these drugs include inhibition of TGF-β expression or activity and inhibition of EMT [79]. Due to its significant role in the progression of CKD and the associated fibrosis, there has been a growing focus on targeting TGF-β or its signaling pathways in recent research [1012]. Furthermore, currently used oral anti-fibrosis medications, such as pirfenidone, have poor patient compliance due to their gastrointestinal side effects. In addition, parenterally administered drugs induce skin color changes or are ineffective in slowing down CKD progression.
EW-7197, an inhibitor of the TGF-β type I receptor (ALK5), has recently been designed as an oral therapeutic option for ulcerative colitis (UC) and cancer [1315]. Preliminary reports have indicated that EW-7197 alleviates renal fibrosis and retards the progression of diabetic nephropathy (DN) in db/db mice [16]. Additionally, there are reports of its ability to inhibit collagen accumulation in unilateral ureteral obstruction mouse kidneys [17]. Therefore, investigating the reno-protective effects of EW-7197 in TGF-β–induced kidney fibrosis is imperative.
In previous research, our group developed a TGF-β1–mediated fibrosis-mimicking device [18]. Using this device, we cultured three types of cells: glomerular epithelial cells, endothelial cells, and tubular epithelial cells. This organ-on-a-chip device employs human cells, which confers numerous advantages over the traditional two-dimensional culture systems or animal models [19]. This system is particularly advantageous due to its utilization of human primary cells, rendering it a more pertinent and human-specific model. Moreover, the ability to evaluate the drug effects within 4 to 5 days constitutes a significant time-saving benefit, facilitating faster decision-making in drug development. This expedited timeline substantially reduces the time and resources required for preclinical testing, ultimately hastening the progress of potential therapies.
The present study focused on examining the EMT process and angiogenic effects through the administration of TGF-β1 and a commercial TGF-β1 inhibitor or EW-7197 to the cells. The primary objective was to clarify the anti-fibrotic effects and proangiogenic properties of EW-7197 on a three-dimensional (3D) renal fibrosis-on-a-chip model and an animal model.

Methods

The study was conducted in accordance with the Declaration of Helsinki and approved by the Ethics Committee of Seoul National University Bundang Hospital (B-2006-621-304). Informed consent was obtained from all human subjects involved in the study. For the animal experiment, the study was approved by the Institutional Animal Care and Use Committee at Seoul National University Bundang Hospital (No. BA-2304-365-003-01). All protocols were executed in accordance with national guidelines for laboratory animals.

Cell culture

We previously described cell culture [18]. Briefly, kidney fibroblasts (KF) were obtained from renal cell carcinoma patients with the estimated glomerular filtration rate >60 mL/min/1.73 m2 and cultured in fibroblast growth medium (FGM-2; Lonza) and they were used at passages 3 to 4. To eliminate epithelial cell contamination during cell culture, magnetic anti-fibroblast beads (Miltenyi Biotec Inc.) were employed after the initial passage. Cells were incubated with anti-fibroblast beads, separated using a magnetic column, and the flow-through was collected. The purified primary fibroblasts were characterized via fluorescence-activated cell sorting (FACS) analysis using phycoerythrin-conjugated anti-fibroblast antibodies. GFP-HUVECs (Lonza) were cultured in endothelial growth medium (EGM-2; Lonza) and cells in passages 3 to 4 were used. HK-2 cells were obtained from the ATCC (American Type Culture Collection) and were grown in high glucose Dulbecco’s modified Eagle’s medium supplemented with 10% fetal bovine serum, penicillin (100 U/mL) and streptomycin (100 U/mL). All reagents were purchased from Gibco. All cells were detached using 0.05% trypsin-ethylenediaminetetraacetic acid and maintained in a humidified incubator at 37 °C and 5% CO2.

Reagents

The matrix was composed of fibrin gels including fibrinogen, aprotinin, and thrombin from bovine plasma. All materials were purchased from Sigma. Fibrinogen was dissolved in 1× phosphate-buffered salin (PBS) at a concentration of 10 mg/mL. Thrombin and aprotinin were dissolved in deionized water at the concentration of 50 units/mL and 4 trypsin inhibitory units/mL. The three solutions were sterilized by filtering through a 0.22-μm filter. Recombinant human TGF-β1 (PeproTech EC Ltd.) and a specific inhibitor of TGF-β receptor kinase, SB431542 (Tocris Cookson, Inc.) were purchased. In the in vitro model, EW-7197 was dissolved in dimethyl sulfoxide (Signal Aldrich). In the animal model, dissolve 2.4 g of sodium phosphate monobasic (Signal Aldrich) in 150 mL of distilled water (DW) and adjust the pH to 3.0 using phosphoric acid (Daejung) to create solution 1. Prepare solution 2 by dissolving 2 g of carboxymethylcellulose sodium salt (Signal Aldrich) in 80 mL of DW. Dissolve 300 mg of EW-7197 in 30 mL of solution 1 to create a stock solution. Adjust the concentration using solution 2 and treat the mice accordingly.

Device fabrication

We previously also described fibrosis chip and device fabrication [18]. Prior to cell seeding, the device undergoes a 1-minute treatment in a plasma machine (Femto Science Inc.) operating at 50 W power. To prevent alterations in hydrophilicity, all experiments are conducted within 30 minutes following plasma treatment. A 250-μL solution of fibrinogen, with 40 μL of aprotinin, is mixed with 710 μL of cell-free 1× PBS. Next, 12.5 μL of this fibrin-aprotinin solution is combined with 37.5 μL of KF suspension (with a cell concentration of 4 × 106 cells/mL) (Fig. 1). Subsequently, 1 μL of thrombin is added to the mixture. Immediately after mixing thrombin with the fibrin-aprotinin solution and KFs suspension, 20 μL of the final mixture containing thrombin is placed at the corner formed by the bottom and sidewalls. Following the attachment process that enables HUVECs to adhere to the fibrin wall, it creates an empty space within, forming a closed channel with only two loading holes at both ends. Subsequently, 10 μL of a fibrin suspension containing HK-2 cells (with a cell concentration of 2 × 107 cells/mL) is injected into the central channel immediately after mixing it with thrombin. Once HUVECs are attached, the device is filled with EGM-2. The device is maintained in a 37 °C and 5% CO2 incubator for a period of 3 days. After 3 days of incubation, the media is replaced, either with or without 5-ng/mL TGF-β1, 10-μM TGF-β1 inhibitor and EW-7197, as part of the experimental procedure.

Immunocytofluorescence

Cells were fixed with 4% paraformaldehyde (Biosesang) for 20 minutes, permeabilized with 0.15% Triton X-100 (Sigma) for 20 minutes, and treated with 3% bovine serum albumin (Sigma) for 1 hour. Cells were treated with primary antibodies (anti-keratin 8 [anti-KRT-8] and anti-alpha smooth muscle actin [anti–α-SMA]) from Abcam for 2 days at room temperature. A secondary antibody, Alexa Fluor 647 (Thermo Fisher Scientific) conjugated donkey anti-rabbit immunoglobulin G (H + L), was used, and DNA labeling was done with Hoechst 33342 (Thermo Fisher Scientific) at a 1:250 dilution for 3 hours at room temperature. Images were captured using a Zeiss LSM 710 confocal laser microscope (Zeiss), and fluorescence intensity was quantified using ImageJ and a fluorescence intensity analyzer.

Real-time polymerase chain reaction

Extraction of RNA was performed with Trizol Reagent (Invitrogen Life Technologies), master mix, and Revert Aid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific) was used for the reverse transcription of the total RNA, and the quantitative polymerase chain reaction (qPCR) was performed using the Applied Biosystems PowerUp SYBR Green Master Mix (Thermo Fisher Scientific). In this experiment, real-time PCR was conducted using the following components: 10 μL of PowerUp SYBR Green Master Mix, 4 μL of cDNA, and 2 pmol of each primer, resulting in a final volume of 20 μL. The reaction was carried out at 95 °C, 1 second and 60 °C, 20 seconds for 45 cycles after denatured at 95 °C for 20 seconds. Data obtained were then normalized to β-actin cDNA. The primer sequences were listed in Table 1, which were prepared by Bioneer.

Cytokine analysis

The V-Plex Cytokine and Angiogenesis Panel 1 Human kit (Merck & Co., Inc.) was used to measure IL-1β. TGF-β1, TGF-β2, and TGF-β3 concentrations were analyzed using a multiplex bead immunoassay system (Procarta Cytokine Assay Kit; Affymetrix, Inc.), based on multiplexing technology (xMAP; Luminex). The data were acquired using a Luminex-compatible workstation and its manager software (Bio-Plex workstation and version 6.0 software; Bio‑Rad Laboratories, Inc.). The TGF-β was detected using Bio-Plex 200 Systems and commercially available Bio‑Plex Pro Human TGF-β assays (Bio‑Rad Laboratories, Inc.). The cytokines from the supernatant have a lower limit of detection measured in pg/mL. Each sample was run as a single measurement for a limited quantity of collected supernatant.

Angiogenesis images

Angiogenesis images were obtained by JULI Stage real-time cell history recorder (NanoEntek) and used a 4× microscope objective lens.

Animals

Seven-week-old male C57BL/6 mice were purchased from Koatech, and the experiment was performed with 9-week-old mice. All protocols were executed in accordance with national guidelines for laboratory animals. Animals were divided into three experimental groups of five animals each: (1) control; (2) cisplatin 7 mg/kg via intraperitoneal (IP) injection, weekly for a 1 month; (3) cisplatin IP weekly with EW-7197 5 mg/kg daily via gavage. Blood urea nitrogen (BUN) tests were performed at 14 weeks after sacrifice using Abbott i-STAT Clinical Chemistry Analyzer.

Western blotting

Tissues were homogenized by mixing with Tissue Protein Extraction Reagent (Thermo Fisher Scientific) at a ratio of 1:20 (w/v). The homogenization was followed by centrifugation at 16,000 ×g and 4 °C for 20 minutes, and the supernatant was collected for further analysis. The protein concentration in the tissue extract was measured using a bicinchoninic acid protein assay. Approximately 30 μg of protein was electrophoresed on a 10% SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis) and subsequently transferred onto nitrocellulose membranes. The membranes were incubated at 4 ℃ overnight with specific primary antibodies (TGF-β: 1:1,000, Abcam; Smad2/3: 1:5,000, Santa Cruz; GAPDH [glyceraldehyde 3-phosphate dehydrogenase]: 1:20,000, Cell Signaling). After washing and incubation with HRP-conjugated secondary antibodies, the bands were detected using the ECL solution. Measurements of expression were using the ImageJ software.

Histopathology

Kidneys from each mouse were fixed in 2% paraformaldehyde-lysine-periodate and embedded in wax. Masson’s trichrome (standard protocol) staining was performed to determine kidney interstitial fibrosis. It was quantified by using an optical microscope (BX53; Olympus). All immunohistochemical staining was analyzed by Scope Eye (version 3.6; JN Optic).

Statistical analysis

The IBM SPSS version 18.0 (IBM Corp.) and GraphPad Prism version 8.0.1 (GraphPad Software, Inc.) were used to perform all statistical analyses. Data are presented as means ± standard deviation and were analyzed using the Student t test or one-way analysis of variance if normality was satisfied according to the Shapiro-Wilk test. If normality was not satisfied, data were presented as median with interquartile range and were analyzed using the Mann-Whitney U test to compare two groups or the Kruskal-Wallis test to compare three or more independent groups. One-way analysis of variance followed by Dunnett’s multiple-comparison test was applied for multiple comparisons. The p-values of less than 0.05 were considered statistically significant.

Results

EW-7197 alleviates the TGF-β1–induced fibrotic response in a 3D chip model

We assessed the effect of EW-7197 on TGF-β1–induced fibrotic response in a 3D chip model. For the analysis, primary human renal fibroblasts were used. FACS was used to examine the samples and determine whether they were positive for the fibroblast marker antibody. After validation, the chip was exposed for 24 hours to TGF-β1 (5 ng/mL) and its specific inhibitor (EW-7197 or 10-μM SB431542). Subsequently, we investigated markers for fibrosis and cytoskeleton in the 3D culture. Immunofluorescent staining assays were conducted to assess the expression of α-SMA and KRT-8. The results indicated that the expression of α-SMA was reduced, while KRT-8 expression was increased by TGF-β1 plus EW-7197 treatment compared to TGF-β1 treatment alone (Fig. 2). These findings indicated a potential anti-fibrotic effect of EW-7197 in TGF-β1–processed HK2 cells on the tri-cell cultured chip.

EW-7197 induced angiogenesis

We further assessed the development of a tubular capillary-like network in the 3D chip model. The vessel was analyzed as thin or thick using 50 µm as the threshold. The vascular damage and loss induced by TGF-β1 treatment was substantially recovered by EW-7197 (Fig. 3A). Fig. 3B and C demonstrate that TGF-β1 treatment led to a decrease in the average diameter of both thick and capillary-like thin vessels. In contrast, EW-7197 increased their average diameter. Furthermore, TGF-β1 led to a reduction in the total length of thick vessels, whereas EW-7197 treatment significantly increased their total length (Fig. 3D). However, the length of the capillary-like thin vessels was decreased by EW-7197 or SB431542 treatment in GFP-HUVECs (Fig. 3E). These findings collectively indicate a potent anti-angiogenic effect of EW-7197 while ameliorating the TGF-β–induced kidney fibrotic response.

EW-7197 plays a role as an angiogenic factor and an anti-inflammatory mediator

The messenger RNA (mRNA) level of TGF-β (a fibrotic factor) was significantly downregulated by EW-7197 than recombinant human TGF-β alone; vascular endothelial growth factor receptor 2 (VEGFR2) mRNA expression (angiogenic factor) was dramatically decreased by TGF-β1 and significantly increased by EW-7197 (Fig. 4). EW-7197 induced the expression of IL-10 (an anti-inflammatory factor) in a dose-dependent manner. IL-10 mRNA expression was meaningfully increased by 50-µM EW-7197 treatment than SB431542 in the 3D cultured chip. The mRNA expression of proinflammatory cytokines, such as IL-1β, IL-6, and IL-8, were upregulated by TGF-β1 inhibitors or EW-7197. Our data suggest that EW-7197 had a better anti-inflammatory and TGF-β inhibitory effect than SB431542.

EW-7197 modulates the secretion of transforming growth factor-β subtypes and inflammatory cytokines

We next investigated the TGF-β subtypes and inflammatory cytokines in the supernatant and found that the secretion of TGF-β1, TGF-β3, and IL-1β was specifically increased by TGF-β. IL-1β was markedly reduced by EW-7197 compared to the TGF-β group (Fig. 5). These findings indicated that EW-7197 was effective in reducing inflammation and fibrosis.

EW-7197 attenuated elevated blood urea nitrogen level and kidney fibrosis in cisplatin-induced kidney fibrosis

The protective effect of EW-7197 5 mg/kg on fibrosis was investigated in an animal model. We induced kidney fibrosis in C57BL/6 mice by administering cisplatin 7 mg/kg via IP injection weekly for 1 month, and EW-7197 was orally administered daily starting at the time of initiation of cisplatin treatment. As expected, administration of cisplatin led to a decrease in body weight, while the group treated with EW-7197 maintained their weight (Fig. 6A). After 4 weeks, the mice were sacrificed and the BUN levels in the serum were measured. The group receiving EW-7197 showed a decrease in BUN compared to the cisplatin-only group (Fig. 6B). Additionally, the expressions of TGF and Smad2/3 were reduced in the EW-7197-treated group (Fig. 6C). The impact of EW-7197 on renal tubulointerstitial fibrosis was assessed using Masson’s trichrome staining (Fig. 6D). The control group showed no signs of renal fibrosis, while cisplatin treatment induced substantial interstitial fibrosis and tubular injury. EW-7197 treatment ameliorated the injury.

Discussion

This study investigated the anti-fibrotic effects of EW-7197, a novel inhibitor of TGF-β type I receptor (or ALK5), on 3D renal fibrosis-on-a-chip model. EW-7197 reduced the fibrotic response in TGF-β1–induced cellular reactions in the 3D chip model, including the tubular EMT, mRNA and protein expression of cytokines, and angiogenesis. In the animal study, the group receiving EW-7197 showed decreased BUN levels compared to the cisplatin-only group. Furthermore, the EW-7197 treated group showed reduced expression of TGF-β and Smad2/3 and decreased renal fibrosis.
In our previous study, using organ-on-chip technology, we developed a TGF-induced fibrosis-mimicking chip by simultaneously culturing primary renal fibroblasts with endothelial and epithelial cells for a short duration [18]. The results demonstrated changes in the profile of EMT, angiogenesis, and inflammatory cytokines. In the present study, we evaluated the anti-fibrotic effects of EW-7197, a potential drug for the treatment of renal fibrosis. The anti-fibrotic and pro-angiogenic effects demonstrated in the 3D renal fibrosis-on-a-chip model were validated in animal experiments, showing not only an improvement in fibrosis but also the prevention of an increase in BUN. This indicates a similar therapeutic effect in both the in vitro and in vivo models.
EW-7197, originally developed as an ALK5 inhibitor in 2004, is currently produced under the name Vactosertib (Medpacto) [14]. It is known to target the adenosine-5-triphosphate binding site of TGF-βR1, thereby inhibiting the phosphorylation of Smad2 and Smad3 proteins, which are the key mediators in TGF-β downstream signaling. TGF-β is known to be a key player in cancer metastasis, as it plays a crucial role in tumor cell proliferation, migration, and invasion [20]. EW-7197, unlike other inhibitors that target the TGF-β pathway, is orally available and exhibits high selectivity for ALK5 EW-7197, unlike other inhibitors that target the TGF-β pathway, is orally available and exhibits high selectivity for ALK5 [14,21]. This makes it a promising candidate for the development of anti-cancer agents targeting the TGF-β pathway. There are several drugs in development targeting the TGF-β signaling pathway, and one such example is Galunisertib, as announced by Eli Lilly [22]. However, Galunisertib has drawbacks compared to Vactosertib, including lower selectivity for ALK5 and the targeting of all three TGF-β isoforms (TGF-β1, TGF-β2, and TGF-β3). Currently, clinical trials of Galunisertib have been discontinued. On the other hand, M7824, which simultaneously targets both TGF-β and PD-L1, may not be the most suitable candidate for evaluating renal utility based on the renal benefits exhibited by EW-7197. EW-7197 is currently undergoing a Phase II study targeting the TGF-β pathway for metastatic pancreatic ductal adenocarcinoma (NCT04258072), desmoid tumors (NCT03802084), and relapsed and/or refractory multiple myeloma (NCT03143985). EW-7197 is undergoing investigation for applications beyond cancer biology. In a murine model of UC, an inflammatory bowel disease, reports have indicated that it exhibits anti-fibrotic effects, reducing histologic scores and mitigating mucosal damage associated with UC. In addition, it has received approval for fibrostenotic Crohn disease from the U.S. Food and Drug Administration for phase 1 clinical trials [23].
In the kidney, similar to cancer cell biology and inflammatory disease, the process of EMT and inflammatory reaction ultimately leads to the development of chronic progressive renal fibrosis, which can eventually progress to end-stage renal disease. In the kidney, similar to cancer cell biology and inflammatory disease, the process of EMT and inflammatory reaction ultimately leads to the development of chronic progressive renal fibrosis, which can eventually progress to end-stage renal disease [24]. TGF-β serves as the master regulator of fibrosis and is involved in EMT in fibrotic kidney disease, inducing differentiation of tubular epithelial cells into cells with a myofibroblast morphology TGF-β serves as the master regulator of fibrosis and is involved in EMT in fibrotic kidney disease, inducing differentiation of tubular epithelial cells into cells with a myofibroblast morphology [25]. In our study, EW-7197 treatment induced a decrease in the expression of α-SMA and an increase in the expression of KRT-8. KRT-8 is considered an epithelial marker in tumor pathology due to its high expression in epithelial structures [26]. It plays a significant role within the keratin protein family by forming a functional dimer with KRT-8 to preserve the structural integrity of epithelial cells [27]. The kidney epithelial cell lines HK-2 and NKi express cytokeratin, which helps maintain cell structure [28,29]. Additionally, loss of KRT-8 in epithelial cancer cells has been reported to increase migration Additionally, loss of KRT-8 in epithelial cancer cells has been reported to increase migration [30]. KRT-8 expression was shown to increase in retinal epithelial cells under stress conditions. Further research is required to better understand the role of KRT-8 in normal epithelial cells, under stress conditions, and during EMT-related changes KRT-8 expression was shown to increase in retinal epithelial cells under stress conditions. Further research is required to better understand the role of KRT-8 in normal epithelial cells, under stress conditions, and during EMT-related changes.
In various kidney diseases, such as DN, ischemic acute kidney injury, glomerulonephritis, and allograft nephropathy, impaired angiogenesis has been suggested to play a pivotal role in the progression of renal fibrosis [31]. Renal fibrosis is accompanied by a decrease in angiogenesis, leading to a reduction in glomerular perfusion. Glomerular perfusion is a critical factor for the survival of endothelial cells. Reduced glomerular perfusion leads to a breakdown of the peritubular capillary network, ultimately progressing to glomerular sclerosis. This, in turn, initiates a vicious cycle of capillary regression, further compromising the survival of endothelial cells in the surrounding areas.
In the context of fibrosis, TGF-β1 exerts its effects on endothelial cells by promoting capillary regression and apoptosis through the ALK5 and Smad 2/3 signaling pathway [25]. In studies of EW-7197 in db/db mice, it was observed that the compound dose-dependently reduced renal collagen IV and fibronectin levels [16]. This reduction correlated with a decrease in TGF-β signaling, particularly Smad 2/3, connective tissue growth factor. In a similar context, our research demonstrates that EW-7197 directly inhibits Smad signaling, thereby suppressing kidney fibrosis.
In our study, the expression of proinflammatory cytokine mRNAs such as IL-1β, IL-6, and IL-8 was decreased by TGF-β, while treatment with EW-7197 or a TGF-β inhibitor SB431542 led to an increase in their expression. However, in the case of IL-1, although mRNA levels increased in response to TGF-β, protein levels were ultimately reduced by EW-7197, as confirmed by cytokine assays. Similar observations of decreased IL-1 expression have been reported in models such as the UC mouse model [23]. Regarding IL-6, knockout studies suggest it may not play a significant role in kidney fibrosis [32]. TGF-β exhibits a paradoxical nature, serving as both a proinflammatory and anti-inflammatory mediator with a dual role. Its impact on cytokine levels appears to be contingent upon the equilibrium between these two roles [33]. Further research is needed to explore the potential for TGF-β inhibition to increase proinflammatory cytokines or to assess the limited impact on the protein levels of effective cytokines.
In a fibrotic setting, TGF-β1 acts as an anti-survival and anti-proliferative factor for endothelial cells. The endothelial cells show a differential response to TGF-β depending on the dose, with low doses promoting angiogenesis, while high doses exert an anti-angiogenic effect [34]. The central mechanism underlying these changes involves a synergistic effect through signaling via proangiogenic factors [35]. Given that VEGFR2 is expressed on the surface of endothelial cells, there is an established epithelial–endothelial crosstalk within renal capillary networks mediated by vascular endothelial growth factor A. In our study, we confirmed the mRNA expression of VEGFR2, a key proangiogenic factor. We observed a decrease in VEGFR2 expression at concentrations of TGF-β that induce fibrosis, and conversely, an increase in VEGFR2 expression in the presence of EW-7197.
Angiogenesis is generally described in two distinct phases: the activation phase and the resolution phase [25,36]. During the activation phase, endothelial cells exhibit sprouting behavior and elongation. This initial stage involves the extension of new blood vessels from existing ones, contributing to the formation of vascular outgrowths. Subsequently, in the resolution phase, adjacent endothelial cells come into contact, leading to a maturation process. This maturation involves the establishment of connections between the endothelial cells, ultimately resulting in the formation of a functional vascular lumen. In the 3D renal fibrosis-on-a-chip model, we observed changes in angiogenesis concomitant with EMT and quantified the differentiation of vessel thickness. The vessel diameter, decreased by TGF-β, showed an increase in both thick and thin vessels after treatment with EW-7197. However, the increase in vessel length under the influence of EW-7197 occurred only in thick vessels. In other words, vessels that have undergone maturation are expected to be better formed and facilitated by EW-7197, creating a more favorable environment within the chip. This enhanced angiogenesis is anticipated to promote effective networking among cells and facilitate the delivery of oxygen and nutrients, thereby optimizing the overall microenvironment for cellular activities within the chip. Further research on vessel changes is warranted, but it is postulated that the inhibition of fibrosis occurs concurrently with the promotion of angiogenesis.
Some limitations of this study should be acknowledged. The dose-dependent effects of EW-7197 on renal anti-fibrotic activity could not be observed. The animal experiments employed in this research were consistent with previous literature, using a UC murine model, and variations based on dosage were also not evident in the cisplatin murine model (data not shown) [23]. Similar findings were noted in an ischemia-reperfusion injury-induced renal fibrosis model (data not shown). These results suggest that the reno-protective effect of EW-7197 may operate at lower concentrations, indicating the need for future research focused on renal physiology. Both the 3D renal fibrosis-on-a-chip model and the mouse model underwent EW-7197 treatment simultaneously with injury, confirming its effects as a preconditioning model. This implies the potential for the development of EW-7197 as a prophylactic agent in the future. However, additional experiments are necessary to determine whether EW-7197 exhibits a reversal effect in models that have already undergone injury. The in vitro 3D renal-fibrosis-on-a-chip model lacks the presence of inflammatory cell infiltration, specifically macrophages, and neutrophils, thus representing a substantial difference from the in vivo cisplatin-induced renal fibrosis mouse model. Immune cells are important components of renal fibrosis [2]. Therefore, considering the limitation of in vitro conditions, additional research is needed.
Despite these limitations, EW-7197 has shown potential as a therapeutic agent for renal fibrosis by selectively targeting the TGF-β type I receptor (or ALK5). Furthermore, experiments conducted with both animal models and the 3D renal fibrosis-on-a-chip model suggest that the organ-on-a-chip system holds promise as a fast and convenient tool for use in preclinical trials.

Notes

Conflicts of interest

All authors have no conflicts of interest to declare.

Funding

This research was supported by the Technology Innovation Program (or Industrial Strategic Technology Development Program-Development of disease models based on 3D microenvironmental platform mimicking multiple organs and evaluation of drug efficacy) (20008413) funded by the Ministry of Trade, Industry & Energy (MOTIE), Korea. This research was supported by the a grand No.2019R1A2C1085411 from the National research Foundation. This research was supported by a grant (RS-2024-00331844) from Ministry of Food and Drug Safety in 2024. This study was also supported by the Young Investigator Research Grant from the Korean Nephrology Research Foundation (2024). This study was funded by Seoul National University Bundang Hospital (grant No.: 02-2021-0004).

Data sharing statement

The data presented in this study are available from the corresponding author upon reasonable request.

Authors’ contributions

Conceptualization: SHH, YC

Data curation, Methodology: SYJ, SHH, WYK, SHP, WMK

Formal analysis: SYJ, SHH, YC, EJK, SK

Funding acquisition, Project administration: SK

Investigation: SYJ, SHH, YC, WYK, SHP, EJK, SK

Supervision: EKJ, SK

Writing–original draft: SYJ, SHH

Writing–review & editing: SYJ, EJK

All authors read and approved the final manuscript.

Acknowledgments

EW-7197 was provided by Biophammer Inc. in Korea. Chips were kindly provided by Curio Chips Inc. in Korea.

Figure 1.

The schematic image of the fabrication for a three-dimensional renal fibrosis-on-a-chip model.

GFP-HUVEC: Lonza.
j-krcp-23-324f1.jpg
Figure 2.

Effect of EW-7197 and SB431542 on the TGF-β1–induced fibrotic response in HK-2 cells using a three-dimensional chip.

The expression of (A, C) alpha smooth muscle actin (α-SMA) and (B, D) keratin 8 (KRT-8), respectively (scale bar, 100 µm).
CON, control group; MFI, mean fluorescence intensity; TGF, transforming growth factor.
*p < 0.05, **p < 0.01 vs. CON by the Student t test; #p < 0.05, ##p < 0.01, ###p < 0.001 vs. TGF-β1 by one-way analysis of variance. Data are presented as mean ± standard deviation; n = 3.
j-krcp-23-324f2.jpg
Figure 3.

Changes in three-dimensional–cultured HUVECs with primary renal fibroblasts and HK-2.

(A) Angiogenesis of HUVEC by transforming growth factor (TGF)-β inhibitors. (B, D) Quantitative analysis of the total length and diameter of thick (diameter, >50 µm) vessels. (C, E) Quantitative analysis of total length and diameter of thin (diameter, <50 µm) vessels.
CON, control group. HUVECs: Lonza.
*p < 0.05, ***p < 0.001 vs. CON by the Student t test; ##p < 0.01, ###p < 0.001 vs. TGF-β1 by one-way analysis of variance. Data are presented as mean ± standard deviation; n = 6.
j-krcp-23-324f3.jpg
Figure 4.

Real-time polymerase chain reaction results showing overall mRNA expression of the three-dimensional chip.

CON, control group; IL, interleukin; mRNA, messenger RNA; TGF, transforming growth factor; VEGFR, vascular endothelial growth factor receptor.
*p < 0.05, **p < 0.01 vs. CON by the Student t test; #p < 0.05, ##p < 0.01 vs. TGF-β1 by one-way analysis of variance. Data are presented as mean ± standard deviation; n = 3.
j-krcp-23-324f4.jpg
Figure 5.

EW-7197 modulates secretory inflammatory cytokine in the supernatant.

CON, control group; IL, interleukin; TGF, transforming growth factor.
**p < 0.01 vs. CON; #p < 0.05, ##p < 0.01, ###p < 0.001 vs. TGF-β1. Data are presented as mean ± standard deviation or median (interquartile range); n = 3–5.
j-krcp-23-324f5.jpg
Figure 6.

EW-7197 attenuates azotemia and TGF-β signaling in cisplatin-induced fibrosis in C57/BL6 mice.

(A) Change in body weight. (B) Serum level of blood urea nitrogen (BUN). (C) Western blots showing protein expression of transforming growth factor (TGF)-β signaling. (D) Masson’s trichrome (MT) staining (×100) of mouse renal tissue.
CON, control group; GAPDH, glyceraldehyde 3-phosphate dehydrogenase.
*p < 0.05 vs. CON; #p < 0.05 vs. cisplatin. Data are presented as median (interquartile range); n = 3–5.
j-krcp-23-324f6.jpg
j-krcp-23-324f7.jpg
Table 1.
Primer sequences used for the quantitative real-time polymerase chain reaction
Gene Forward sequence (5′-3′) Reverse sequence (5′-3′)
IL1β ATGATGGCTTATTACAGTGGC GTCGGAGAGATTCGTAGCTGGA
IL6 AAAGAGGCACTGGCAGAAA TTTCACCAGGCAAGTCTCCT
IL8 GACCACACTGCGCCAACAC CTTCTCCACAACCCTCTGCAC
TGFβ1 CCCAGCATCTGCAAAGCTC GTCAATGTACAGCTGCCGCA
VEGFR2 CCAGCAAAAGCAGGGAGTCTGT TGTCTGTGTCATCGGAGTGATATCC
IL10 TTGCCAAGCCTTGTCTGA AGGGAGTTCACATGCGCCT
ACTB TCACCATTGGCAATGAGCGG AGTTTCGTGGATGCCACAG

References

1. Oh KH, Kang MJ, Kang EJ. What we have learned about chronic kidney diseases. Kidney Res Clin Pract 2022;39:121–135.
crossref
2. Huang R, Fu P, Ma L. Kidney fibrosis: from mechanisms to therapeutic medicines. Signal Transduct Target Ther 2023;8:129.
crossref pmid pmc pdf
3. Anthony TP, Tang SCW. Advances in the management of diabetic kidney disease: beyond sodium-glucose co-transporter 2 inhibitors. Kidney Res Clin Pract 2022;41:682–698.
crossref pmid pmc
4. Zhang F, Liu H, Liu D, et al. Effects of RAAS inhibitors in patients with kidney disease. Curr Hypertens Rep 2017;19:72.
crossref pmid pdf
5. Wen Y, Liu Y, Tang T, et al. NLRP3 inflammasome activation is involved in Ang II-induced kidney damage via mitochondrial dysfunction. Oncotarget 2016;7:54290–54302.
crossref pmid pmc
6. Oe Y, Vallon V. The pathophysiological basis of diabetic kidney protection by inhibition of SGLT2 and SGLT1. Kidney Dial 2022;2:349–368.
crossref pmid pmc
7. Jaikumkao K, Pongchaidecha A, Chueakula N, et al. Dapagliflozin, a sodium-glucose co-transporter-2 inhibitor, slows the progression of renal complications through the suppression of renal inflammation, endoplasmic reticulum stress and apoptosis in prediabetic rats. Diabetes Obes Metab 2018;20:2617–2626.
crossref pmid pdf
8. Huang F, Zhao Y, Wang Q, et al. Dapagliflozin attenuates renal tubulointerstitial fibrosis associated with type 1 diabetes by regulating STAT1/TGFβ1 signaling. Front Endocrinol (Lausanne) 2019;10:441.
crossref pmid pmc
9. Das NA, Carpenter AJ, Belenchia A, et al. Empagliflozin reduces high glucose-induced oxidative stress and miR-21-dependent TRAF3IP2 induction and RECK suppression, and inhibits human renal proximal tubular epithelial cell migration and epithelial-to-mesenchymal transition. Cell Signal 2020;68:109506.
crossref pmid
10. Sharma K, Ix JH, Mathew AV, et al. Pirfenidone for diabetic nephropathy. J Am Soc Nephrol 2011;22:1144–1151.
crossref pmid pmc
11. Vincenti F, Fervenza FC, Campbell KN, et al. A phase 2, double-blind, placebo-controlled, randomized study of fresolimumab in patients with steroid-resistant primary focal segmental glomerulosclerosis. Kidney Int Rep 2017;2:800–810.
crossref pmid pmc
12. Voelker J, Berg PH, Sheetz M, et al. Anti-TGF-β1 antibody therapy in patients with diabetic nephropathy. J Am Soc Nephrol 2017;28:953–962.
crossref pmid
13. Jung SY, Park JH, Baek MJ, et al. Development of an oral bentonite-based modified-release freeze-dried powder of vactosertib: pharmacokinetics and anti-colitis activity in rodent models of ulcerative colitis. Int J Pharm 2020;578:119103.
crossref pmid
14. Jin CH, Krishnaiah M, Sreenu D, et al. Discovery of N-((4-([1,2,4]triazolo[1,5-a]pyridin-6-yl)-5-(6-methylpyridin-2-yl)-1H-imidazol-2-yl)methyl)-2-fluoroaniline (EW-7197): a highly potent, selective, and orally bioavailable inhibitor of TGF-β type I receptor kinase as cancer immunotherapeutic/antifibrotic agent. J Med Chem 2014;57:4213–4238.
crossref pmid
15. Lee JE, Lee P, Yoon YC, et al. Vactosertib, TGF-β receptor I inhibitor, augments the sensitization of the anti-cancer activity of gemcitabine in pancreatic cancer. Biomed Pharmacother 2023;162:114716.
crossref pmid
16. Ha KB, Sangartit W, Jeong AR, et al. EW-7197 attenuates the progression of diabetic nephropathy in db/db mice through suppression of fibrogenesis and inflammation. Endocrinol Metab (Seoul) 2022;37:96–111.
crossref pmid pmc pdf
17. Nan QY, Piao SG, Jin JZ, Chung BH, Yang CW, Li C. Pathogenesis and management of renal fibrosis induced by unilateral ureteral obstruction. Kidney Res Clin Pract 2024;43:586–599.
crossref pmid pdf
18. Hwang SH, Lee YM, Choi Y, et al. Role of human primary renal fibroblast in TGF-β1-mediated fibrosis-mimicking devices. Int J Mol Sci 2021;22:10758.
crossref pmid pmc
19. Kwon EJ, Hwang SH, Seo S, Park J, Park S, Kim S. Efficacy of mesenchymal-stromal-cell-derived extracellular vesicles in ameliorating cisplatin nephrotoxicity, as modeled using three-dimensional, gravity-driven, two-layer tubule-on-a-chip (3D-MOTIVE chip). Int J Mol Sci 2023;24:15726.
crossref pmid pmc
20. Kim BG, Malek E, Choi SH, Ignatz-Hoover JJ, Driscoll JJ. Novel therapies emerging in oncology to target the TGF-β pathway. J Hematol Oncol 2021;14:55.
crossref pmid pmc pdf
21. Son JY, Park SY, Kim SJ, et al. EW-7197, a novel ALK-5 kinase inhibitor, potently inhibits breast to lung metastasis. Mol Cancer Ther 2014;13:1704–1716.
crossref pmid pdf
22. Hanke T, Wong JF, Berger BT, et al. A highly selective chemical probe for activin receptor-like kinases ALK4 and ALK5. ACS Chem Biol 2020;15:862–870.
crossref pmid
23. Binabaj MM, Asgharzadeh F, Avan A, et al. EW-7197 prevents ulcerative colitis-associated fibrosis and inflammation. J Cell Physiol 2019;234:11654–11661.
crossref pmid pdf
24. Webster AC, Nagler EV, Morton RL, Masson P. Chronic kidney disease. Lancet 2017;389:1238–1252.
crossref pmid
25. Pardali E, Goumans MJ, ten Dijke P. Signaling by members of the TGF-beta family in vascular morphogenesis and disease. Trends Cell Biol 2010;20:556–567.
pmid
26. Owusu-Akyaw A, Krishnamoorthy K, Goldsmith LT, Morelli SS. The role of mesenchymal-epithelial transition in endometrial function. Hum Reprod Update 2019;25:114–133.
crossref pmid
27. Miao Q, Xu Y, Yin H, Zhang H, Ye J. KRT8 phosphorylation regulates the epithelial-mesenchymal transition in retinal pigment epithelial cells through autophagy modulation. J Cell Mol Med 2020;24:3217–3228.
crossref pmid pmc pdf
28. Ryan MJ, Johnson G, Kirk J, Fuerstenberg SM, Zager RA, Torok-Storb B. HK-2: an immortalized proximal tubule epithelial cell line from normal adult human kidney. Kidney Int 1994;45:48–57.
crossref pmid
29. DesRochers TM, Suter L, Roth A, Kaplan DL. Bioengineered 3D human kidney tissue, a platform for the determination of nephrotoxicity. PLoS One 2013;8:e59219.
crossref pmid pmc
30. Fortier AM, Asselin E, Cadrin M. Keratin 8 and 18 loss in epithelial cancer cells increases collective cell migration and cisplatin sensitivity through claudin1 up-regulation. J Biol Chem 2013;288:11555–11571.
crossref pmid pmc
31. Ballermann BJ, Obeidat M. Tipping the balance from angiogenesis to fibrosis in CKD. Kidney Int Suppl (2011) 2014;4:45–52.
crossref pmid pmc
32. Yang J, Chen J, Yan J, et al. Effect of interleukin 6 deficiency on renal interstitial fibrosis. PLoS One 2012;7:e52415.
crossref pmid pmc
33. Clancy RM, Buyon JP. Clearance of apoptotic cells: TGF-beta in the balance between inflammation and fibrosis. J Leukoc Biol 2003;74:959–960.
pmid
34. Pepper MS. Transforming growth factor-beta: vasculogenesis, angiogenesis, and vessel wall integrity. Cytokine Growth Factor Rev 1997;8:21–43.
crossref pmid
35. Tanabe K, Wada J, Sato Y. Targeting angiogenesis and lymphangiogenesis in kidney disease. Nat Rev Nephrol 2020;16:289–303.
crossref pmid pdf
36. Czirok A, Little CD. Pattern formation during vasculogenesis. Birth Defects Res C Embryo Today 2012;96:153–162.
crossref pmid pmc


ABOUT
BROWSE ARTICLES
EDITORIAL POLICY
FOR CONTRIBUTORS
Editorial Office
#301, (Miseung Bldg.) 23, Apgujenog-ro 30-gil, Gangnam-gu, Seoul 06022, Korea
Tel: +82-2-3486-8736    Fax: +82-2-3486-8737    E-mail: registry@ksn.or.kr                

Copyright © 2026 by The Korean Society of Nephrology.

Developed in M2PI

Close layer